Tradersglobal scientific ltd.
Activity value 90 International Buyer&Supplier, the last transaction date was 2024-09-25 Address: 9a ellerbeck court stokesley ts95pt
Accurate Match
International Firm
Sourcing from China
Buyer/Supplier：
×Not shown
Number of Transactions Quantity Weight
Number of Transactions Quantity Weight
The following trade report data is derived from its trade data; the company's import data up to 2024-09-25 total 3572 transactions. Based on these trade data, we have aggregated the data in terms of trading partners, import and export ports, countries of supply, HS codes, contact details and other dimensions, which will help you to improve the efficiency of using your foreign trade data.
The graph above shows the market trend analysis of global scientific ltd. for the past year, which can be used to understand the current supply cycle and business stability of the company from the trend of different dimensions such as quantity, weight, price and number of transactions.
- Year Transactions Quantity Weight
Bill of lading data
< 1/15 >Only shown the last 15 items, click more to check all
- Trade date 2024/09/25 B/L No. 5828644
- Supplier circle h2o llc Buyers global scientific ltd.
- POLs —— PODs ahemdabad air
- Supply area China Purchas area India
- Weight —— Amount 6720
- Hs code 84219900 Product tags e meter,ice,membrane module,ail,spm,ore
- Product description POREFLON MEMBRANE MODULE SPMW-12B6-K (6 SQURE METER @ 16 SETS TOTAL 96 SQURE METER)(DETAILS AS PER INVOICE AND P.LIST)
- Trade date 2024/08/29 B/L No. ——
- Supplier deutsches referenzburo fur ringversuche und referenzmaterialien gmbh Buyers global scientific ltd.
- POLs —— PODs ——
- Supply area Germany Purchas area Vietnam
- Weight ——kg Amount 513.467
- Hs code 38229090 Product tags ——
- Product description DRRR-PT-2010320 Registration proficiency testing mineral oil in edible fat and edible oil samples, used to test mineral oil in edible fat
- Trade date 2024/08/27 B/L No. ——
- Supplier ifm quality services pvt ltd. Buyers global scientific ltd.
- POLs —— PODs ——
- Supply area Australia Purchas area Vietnam
- Weight ——kg Amount 762.4
- Hs code 38229090 Product tags ——
- Product description Test sample IFM-PT-24NP3 Count Plate Count and Anaerobic count, Bacillus cereus, E. coli, Enterobacteriaceae,... in food samples, used for microbiological testing in food, 3x25g/box, 100% new commitment
- Trade date 2024/08/22 B/L No. ——
- Supplier lgc standards Buyers global scientific ltd.
- POLs —— PODs ——
- Supply area England Purchas area Vietnam
- Weight ——kg Amount 476.628
- Hs code 38229090 Product tags ——
- Product description Test sample LGC-PT-TY110-10 Analysis of Phthalates in Section of rubber material samples, used to test Phthalates in rubber, 100% new
- Trade date 2024/08/22 B/L No. ——
- Supplier lgc standards Buyers global scientific ltd.
- POLs —— PODs ——
- Supply area England Purchas area Vietnam
- Weight ——kg Amount 370.553
- Hs code 38229090 Product tags ——
- Product description Test sample LGC-PT-FC340-857 Analysis of Ethylene oxide as a sum of ethylene oxide and 2-CE;... in food samples, used to test Ethylene oxide residue in food, 20g/box, 100% new
- Trade date 2024/08/22 B/L No. ——
- Supplier lgc standards Buyers global scientific ltd.
- POLs —— PODs ——
- Supply area England Purchas area Vietnam
- Weight ——kg Amount 370.553
- Hs code 38229090 Product tags ——
- Product description Test sample LGC-PT-FC340-777 Analysis of pesticides in Dried green tea samples, used to test pesticide residues in dried green tea, 2x50g/box, 100% new
- Trade date 2024/08/22 B/L No. ——
- Supplier lgc standards Buyers global scientific ltd.
- POLs —— PODs ——
- Supply area England Purchas area Vietnam
- Weight ——kg Amount 602.736
- Hs code 38229090 Product tags ——
- Product description Test sample LGC-PT-TY110-03 EN71 Part 3 in paint flakes samples, used to test toy safety, 100% new
- Trade date 2024/08/22 B/L No. ——
- Supplier lgc standards Buyers global scientific ltd.
- POLs —— PODs ——
- Supply area England Purchas area Vietnam
- Weight ——kg Amount 807.443
- Hs code 38229090 Product tags ——
- Product description Test sample LGC-PT-TY110-09 Analysis of total: lead, cadmium, chromium, nickel, tin, mercur in dried paint flakes samples, used to test metal residue in paint, 100% new
- Trade date 2024/08/22 B/L No. ——
- Supplier lgc standards Buyers global scientific ltd.
- POLs —— PODs ——
- Supply area England Purchas area Vietnam
- Weight ——kg Amount 431.308
- Hs code 38229090 Product tags ——
- Product description Test sample LGC-PT-FC340-811 Analysis of energy, fat, saturates, carbohydrates; total sugars, protein, salt;... in ketchup samples, used to test nutrition in ketchup, 200g/box, 100% new
- Trade date 2024/08/22 B/L No. ——
- Supplier lgc standards Buyers global scientific ltd.
- POLs —— PODs ——
- Supply area England Purchas area Vietnam
- Weight ——kg Amount 370.553
- Hs code 38229090 Product tags ——
- Product description Test sample LGC-PT-FC340-868 Analysis of Ethylene oxide as a sum of ethylene oxide and 2-CE;... in food samples, used to test Ethylene oxide residue in food, 60g/box, 100% new
- Trade date 2024/08/22 B/L No. ——
- Supplier lgc standards Buyers global scientific ltd.
- POLs —— PODs ——
- Supply area England Purchas area Vietnam
- Weight ——kg Amount 485.824
- Hs code 38229090 Product tags ——
- Product description LGC-PT-FC340-781 Analysis of gluten in flour samples, used to test gluten in flour, 100g/box, 100% new
- Trade date 2024/08/22 B/L No. ——
- Supplier lgc standards Buyers global scientific ltd.
- POLs —— PODs ——
- Supply area England Purchas area Vietnam
- Weight ——kg Amount 117.57
- Hs code 38229090 Product tags ——
- Product description Test sample LGC-PT-TY110-03-X Repeat EN71 Part 3 in paint flakes samples, used to test toy safety, 100% new
- Trade date 2024/08/22 B/L No. ——
- Supplier lgc standards Buyers global scientific ltd.
- POLs —— PODs ——
- Supply area England Purchas area Vietnam
- Weight ——kg Amount 489.327
- Hs code 38229090 Product tags ——
- Product description Test sample LGC-PT-FC340-839 Analysis of Pesticides in root and tuber vegetables samples, used to check pesticide residues in vegetables, 2x50g/box, 100% new
- Trade date 2024/08/21 B/L No. ——
- Supplier azenta usa inc. Buyers global scientific ltd.
- POLs —— PODs ——
- Supply area China Purchas area Vietnam
- Weight ——kg Amount 167.85
- Hs code 38229090 Product tags ——
- Product description Plasmid_Vpara_TDH Test Substance Plasmid_Vpara_TDH (270 bp), 2-5ug/vial, freeze dried, for laboratory nucleic acid analysis, 100% new
- Trade date 2024/08/21 B/L No. ——
- Supplier azenta usa inc. Buyers global scientific ltd.
- POLs —— PODs ——
- Supply area China Purchas area Vietnam
- Weight ——kg Amount 7.55
- Hs code 38229090 Product tags ——
- Product description Test substance V_for F_SR V.for F(SR): TTAAGCGTTTTCGCTGAGAATG, 100nM/vial, for laboratory nucleic acid analysis, 100% new
Partners
- Rank Company Transactions Per Detail
- 1 azenta usa inc. chinasupplier,they trade on 2024-08-21 614 17.19% >
- 2 lgc standards papua new guineasupplier,they trade on 2024-08-22 540 15.12% >
- 3 nike chemical india indiasupplier,they trade on 2022-03-23 396 11.09% >
- 4 chromagar 2740 francesupplier,they trade on 2024-07-28 269 7.53% >
- 5 cosmo laboratory equipment indiabuyer,they trade on 2024-03-29 154 4.31% > +View All
Products
- Products Transactions Per Detail
-
estradiol
437 28.34% > -
laboratory reagents
437 28.34% > -
soybean
277 17.96% > -
lab tube
16 1.04% > -
hardened plastic
15 0.97% >
+View All
Hscode rank
- HSCode Name Transactions Per Detail
- 38229090 631 40.92% >
- 38220090 437 28.34% >
- 38210010 277 17.96% >
- 90183990 17 1.1% >
- 39269099 15 0.97% > +View All
Trading Area
- Area Transactions Per Detail
- india 999 27.97% >
- papua new guinea 676 18.92% >
- china 646 18.09% >
- england 323 9.04% >
- france 271 7.59% > +View All
Port statistics
- Port Name Transactions Per Detail
- ho chi minh airport vn 667 18.67% >
- nepalganj 343 9.6% >
- cengkareng sukarno hatta u 41 1.15% >
- ho chi minh 23 0.64% >
- lpaf 15 0.42% > +View All
global scientific ltd. is A England Buyer. This Company's Trade Report Mainly Contains Market Analysis, Contact, Trade Partners, Ports Statistics, And Trade Area Analysis. Official Reference Contact Is From England Original Bill Of Ladings, Including Email, Phone, Fax, Address, And Official Website. Till 2024-09-25，global scientific ltd.. A Total Of 3572 Transactions. Follow Up The Company, And Then Can Export This Company's Contact And B/Ls. If There Is New Transactions, We Will Also Inform You By The System.
We Extract The Trade Partners From global scientific ltd.'S 3572 Transctions. You Can Screen Companies By Transactions, Trade Date, And Trading Area. While You Can Check Product Type, Quantity, Price, And Trade Frequency Of Each Transaction. This Data Will Help You Study Your Competitors, Maintain And Monitor Your Customers, And Develop Target Users. Through Summary Statistics Of Transaction，We Extract This Company's Data Of Import-Export Ports And Trade Area, And Then You Can Check Related Data. It Can Calculate The Main Market And Occupation Of global scientific ltd.. All Around The World. Help You Deeply Analyze The Target Market, And Scientifically Formulate Production And Marketing Strategies.
Besides, We Are Trying Our Best To Provide Accurate Target Customers Recommend. Through Big Data, Recommend The Company That Buying Or Supplying The Same Product (Or HS Code) From The England's Buyer Company Database. That Including Email And Have Transaction Recently Will Be Pushed. So Suggest You Follow global scientific ltd., At The Same Time, Mark This Company's Industry And Products, It Will Help You Receive More Accurate Data Push.
We Extract The Trade Partners From global scientific ltd.'S 3572 Transctions. You Can Screen Companies By Transactions, Trade Date, And Trading Area. While You Can Check Product Type, Quantity, Price, And Trade Frequency Of Each Transaction. This Data Will Help You Study Your Competitors, Maintain And Monitor Your Customers, And Develop Target Users. Through Summary Statistics Of Transaction，We Extract This Company's Data Of Import-Export Ports And Trade Area, And Then You Can Check Related Data. It Can Calculate The Main Market And Occupation Of global scientific ltd.. All Around The World. Help You Deeply Analyze The Target Market, And Scientifically Formulate Production And Marketing Strategies.
Besides, We Are Trying Our Best To Provide Accurate Target Customers Recommend. Through Big Data, Recommend The Company That Buying Or Supplying The Same Product (Or HS Code) From The England's Buyer Company Database. That Including Email And Have Transaction Recently Will Be Pushed. So Suggest You Follow global scientific ltd., At The Same Time, Mark This Company's Industry And Products, It Will Help You Receive More Accurate Data Push.
Reference contact info
Business Information
Peer companies
-
financial technologies group ltd.
Buyer，Activity value 82 -
express dispense ltd.
Buyer，Activity value 67 -
prasinus ltd.
Buyer，Activity value 62 -
jo fuertes
Buyer，Activity value 61 -
heera worldwide ltd.
Supplier，Activity value 65