azenta usa inc.
Trade trend analysis
Mon
|
Year
Number of Transactions Quantity Weight
Number of Transactions Quantity Weight
The above chart presents the market trend analysis for azenta usa inc. from 2025 to 2026. By examining various dimensions such as transaction quantity, transaction weight, average price, and transaction frequency, we can gain an intuitive understanding of the company's performance in terms of procurement cycles, business scale, and stability. As of 2026, the company has completed 53 transactions, with a transaction quantity of 229 and a transaction weight of 0.
- Year Transactions Quantity Weight
- 2025 724 1579.19 34.19
- 2026 53 229 0
Bill of lading data
< 1/15 >- Trade date 2026/02/27 B/L No. 108006732411
- Suppliers azenta usa inc. Buyers công ty cổ phần công nghệ tbr
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight —— Amount 774.700046
- Hs code 38229090 Product tags ——
- Product description Chất thử đoạn acid nucleic (Oligo-Flex DNA synthesis), 100 nmol/ống, (dùng trong lĩnh vực nghiên cứu thực vật trong phòng thí nghiệm), hàng mới 100% Expand
- Trade date 2026/02/27 B/L No. 108006732411
- Suppliers azenta usa inc. Buyers công ty cổ phần công nghệ tbr
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight —— Amount 4827.52
- Hs code 38229090 Product tags ——
- Product description Chất thử đoạn acid nucleic (FAM-MGB DNA synthesis), 200 nmol/ống, (dùng trong lĩnh vực nghiên cứu thực vật trong phòng thí nghiệm), hàng mới 100% Expand
- Trade date 2026/02/27 B/L No. 108006732411
- Suppliers azenta usa inc. Buyers công ty cổ phần công nghệ tbr
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight —— Amount 197.42
- Hs code 38229090 Product tags ——
- Product description Chất thử đoạn acid nucleic (FAM-BHQ-1 DNA synthesis), 200 nmol/ống, (dùng trong lĩnh vực nghiên cứu thực vật trong phòng thí nghiệm), hàng mới 100% Expand
- Trade date 2026/02/27 B/L No. 108006732411
- Suppliers azenta usa inc. Buyers công ty cổ phần công nghệ tbr
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight —— Amount 881.800002
- Hs code 38229090 Product tags ——
- Product description Chất thử đoạn acid nucleic (Synthetic DNA), 4 microgram/ống, (dùng trong lĩnh vực nghiên cứu thực vật trong phòng thí nghiệm), hàng mới 100% Expand
- Trade date 2026/02/27 B/L No. 108006732411
- Suppliers azenta usa inc. Buyers công ty cổ phần công nghệ tbr
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight —— Amount 3472.15986
- Hs code 38229090 Product tags ——
- Product description Chất thử đoạn acid nucleic (FAM-BHQ-1 DNA synthesis), 100 nmol/ống, (dùng trong lĩnh vực nghiên cứu thực vật trong phòng thí nghiệm), hàng mới 100% Expand
- Trade date 2026/02/27 B/L No. 108006732411
- Suppliers azenta usa inc. Buyers công ty cổ phần công nghệ tbr
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight —— Amount 544.72
- Hs code 38229090 Product tags ——
- Product description Chất thử đoạn acid nucleic (FAM-TAMRA DNA synthesis), 100 nmol/ống, (dùng trong lĩnh vực nghiên cứu thực vật trong phòng thí nghiệm), hàng mới 100% Expand
- Trade date 2026/02/27 B/L No. 108006732411
- Suppliers azenta usa inc. Buyers công ty cổ phần công nghệ tbr
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight —— Amount 218.1
- Hs code 38229090 Product tags ——
- Product description Chất thử đoạn acid nucleic (Texas Red-BHQ-1 DNA synthesis), 100 nmol/ống, (dùng trong lĩnh vực nghiên cứu thực vật trong phòng thí nghiệm), hàng mới 100% Expand
- Trade date 2026/02/27 B/L No. 108006732411
- Suppliers azenta usa inc. Buyers công ty cổ phần công nghệ tbr
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight —— Amount 219.8
- Hs code 38229090 Product tags ——
- Product description Chất thử đoạn acid nucleic (Texas Red-BHQ-2 DNA synthesis), 100 nmol/ống, (dùng trong lĩnh vực nghiên cứu thực vật trong phòng thí nghiệm), hàng mới 100% Expand
- Trade date 2026/02/27 B/L No. 108006732411
- Suppliers azenta usa inc. Buyers công ty cổ phần công nghệ tbr
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight —— Amount 142.88
- Hs code 38229090 Product tags ——
- Product description Chất thử đoạn acid nucleic (HEX-BHQ-1 DNA synthesis), 100 nmol/ống, (dùng trong lĩnh vực nghiên cứu thực vật trong phòng thí nghiệm), hàng mới 100% Expand
- Trade date 2026/02/27 B/L No. 108006732411
- Suppliers azenta usa inc. Buyers công ty cổ phần công nghệ tbr
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight —— Amount 494.28999
- Hs code 38229090 Product tags ——
- Product description Chất thử đoạn acid nucleic (CY-5-BHQ-1 DNA synthesis), 100 nmol/ống, (dùng trong lĩnh vực nghiên cứu thực vật trong phòng thí nghiệm), hàng mới 100% Expand
- Trade date 2026/02/23 B/L No. 5822356
- Suppliers azenta usa inc. Buyers sun pharmaceutical industries lilmited
- POLs —— PODs mumbai (ex bombay)
- Supply area Korea Purchas area India
- Weight —— Amount 189.75
- Hs code 38229090 Product tags reference standard,beli,mab,cosi,working
- Product description 177745 WORKING REFERENCE STANDARD COSIBELIMAB 60MG ML NACI FOC 177745 WORKING REFERENCE STANDARD COSIBELIMAB 60MG ML NACI Expand
- Trade date 2026/02/11 B/L No. 107982491521
- Suppliers azenta usa inc. Buyers công ty cổ phần giải pháp y tế và khoa học suran
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight —— Amount 69
- Hs code 38229090 Product tags ——
- Product description Chất thử Oligo DNA tổng hơp (FragmentGENE đoạn 100-250 bp),t/p là các nucleotide, đóng gói 500ng/ống, đựng trong 1 ống, dùng trong phòng thí nghiệm, không dùng cho y tế, mới 100% Expand
- Trade date 2026/01/26 B/L No. 107924971341
- Suppliers azenta usa inc. Buyers công ty tnhh khoa học kỹ thuật toàn cầu
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight —— Amount 6.79
- Hs code 38229090 Product tags ——
- Product description Chất thử nghiệm pUC19_R Primer GCAGAGCGCAGATACCAAAT; DSL -100nMole/vial; dùng cho phân tích acid nucleic trong phòng thí nghiệm, mới 100% Expand
- Trade date 2026/01/26 B/L No. 107924971341
- Suppliers azenta usa inc. Buyers công ty tnhh khoa học kỹ thuật toàn cầu
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight —— Amount 133.13
- Hs code 38229090 Product tags ——
- Product description Chất thử nghiệm pUC19_P Probe 5'-HEX-AGAGCGAGGTATGTAGGCGG3'-BHQ1; HPLC -100nMole/vial, dùng cho phân tích acid nucleic trong phòng thí nghiệm, mới 100% Expand
- Trade date 2026/01/26 B/L No. 107924971341
- Suppliers azenta usa inc. Buyers công ty tnhh khoa học kỹ thuật toàn cầu
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight —— Amount 6.79
- Hs code 38229090 Product tags ——
- Product description Chất thử nghiệm Primer_R2 Primer ACACTCGAATCTCTTCAAGT; DSL -100nMole/vial; dùng cho phân tích acid nucleic trong phòng thí nghiệm, mới 100% Expand
Partners
Total 33- Rank Company Transactions Per Detail
- 1 công ty tnhh khoa học kỹ thuật toàn cầu vietnambuyer,they trade on 2026-01-26 796 33.42% >
- 2 global scientific ltd. englandbuyer,they trade on 2024-08-21 614 25.78% >
- 3 tbr technology corporation vietnambuyer,they trade on 2024-08-28 324 13.6% >
- 4 dai xuan biomedical joint stock co vietnambuyer,they trade on 2024-07-19 210 8.82% >
- 5 công ty cổ phần công nghệ tbr vietnambuyer,they trade on 2025-12-17 106 4.45% > +View All
Products
Total 48- Products Transactions Per Detail
-
hardened plastic
6 0.52% > -
stainless steel
6 0.52% > -
buprofezin
3 0.26% > -
selendazole
3 0.26% > -
assy
2 0.17% >
+View All
Hscode rank
Total 27- HSCode Name Transactions Per Detail
- HS 38229090 1127 97.66% >
- HS 39269099 6 0.52% >
- HS 84185000 3 0.26% >
- HS 2934999000 3 0.26% >
- HS 85059090 2 0.17% > +View All
Trading Area
Total 5- Area Transactions Per Detail
- vietnam 2321 97.4% >
- india 32 1.34% >
- ecuador 23 0.97% >
- colombia 6 0.25% >
- brazil 1 0.04% >
Port statistics
Total 6- Port Name Transactions Per Detail
- suzhou cn 120 5.01% >
- indianapolis in us 21 0.88% >
- miami 10 0.42% >
- united states 7 0.29% >
- indianapolis in 1 0.04% > +View All
azenta usa inc. is International Buyer&Supplier,
and primarily engages in the import and export business of products such as hardened plastic，stainless steel，buprofezin.
According to the 52wmb.com global trade database, as of 2026-02-27, the company has completed 3016 international trades,
with its main trading regions covering vietnam，india,ecuador etc.
The core products include HS38229090，HS39269099，HS84185000 etc,
often transported via suzhou cn，port indianapolis in us, port miami etc,
and its main trading partners are công ty tnhh khoa học kỹ thuật toàn cầu，global scientific ltd.，tbr technology corporation.
These trade data are sourced from various countries' customs and public channels, and have undergone standardization and structuring processing.
They can reflect the import and export trends and main market layout of the enterprise, and are suitable for market trend analysis, competitor research, port transportation planning, supply chain optimization, and international customer development.
They provide reliable support for cross-border trade decision-making.
The trade data displayed on azenta usa inc. is sourced from the 52wmb.com global trade database. It is based on legal records from customs and related public channels of various countries, and has been formatted and organized for user query and analysis.
We maintain compliance with the source and processing of data to ensure the objectivity of information, but due to the dynamic changes in international trade activities, some data may be delayed or changed.
Reference contact info
Email Hunting Tool