Tradersbce vietnam co.ltd.
Activity value 77 vietnam Buyer&Supplier, the last transaction date was 2024-08-30 Address: trung hoa nhan chinh, suite 606-24t1vinaconex bldg., cau giay dist, hanoi, vi
Accurate Match
Sourcing from China
Buyer/Supplier：
×Not shown
Number of Transactions Quantity Weight
Number of Transactions Quantity Weight
The following trade report data is derived from its trade data; the company's import data up to 2024-08-30 total 16199 transactions. Based on these trade data, we have aggregated the data in terms of trading partners, import and export ports, countries of supply, HS codes, contact details and other dimensions, which will help you to improve the efficiency of using your foreign trade data.
The graph above shows the market trend analysis of bce vietnam co.ltd. for the past year, which can be used to understand the current supply cycle and business stability of the company from the trend of different dimensions such as quantity, weight, price and number of transactions.
- Year Transactions Quantity Weight
Bill of lading data
< 1/15 >Only shown the last 15 items, click more to check all
- Trade date 2024/08/30 B/L No. ——
- Supplier integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 19724
- Hs code 38229090 Product tags ——
- Product description Reagent for laboratory use, not for medical use, product name: xGen Custom Hyb Panel, 96 reactions - 10 ml/bottle, code: GS_NIPT30SingleGenes_woUTR-V1, Manufacturer: IDT, 100% new, CAS number: 56-81-5
- Trade date 2024/08/29 B/L No. ——
- Supplier integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 19.22
- Hs code 38229090 Product tags ——
- Product description Reagent used in experiments, product name: 100 nmole DNA Oligos, 0.1 ml/vial, sequence: CTG CTC ATG GTA TCA ATC TTA TCG A, code: 2F, Manufacturer: IDT, 100% new, CAS number: 56-81-5
- Trade date 2024/08/29 B/L No. ——
- Supplier integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 5.54
- Hs code 38229090 Product tags ——
- Product description Reagent used in the experiment, product name: 25 nmole DNA Oligos, 0.1 ml/vial, sequence: GGTTGGGTCTGCAGTTGAAG, code: OmpANhiF, Manufacturer: IDT, 100% new, CAS number: 56-81-5
- Trade date 2024/08/29 B/L No. ——
- Supplier integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 8.84
- Hs code 38229090 Product tags ——
- Product description Reagent used in the experiment, product name: 100 nmole DNA Oligos, 0.1 ml/vial, sequence: ATAAATCGCCATTCGTTGACTAC, code: stx1-F, Manufacturer: IDT, 100% new, CAS number: 56-81-5
- Trade date 2024/08/29 B/L No. ——
- Supplier integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 5.25
- Hs code 38229090 Product tags ——
- Product description Reagent used in experiments, product name: 25 nmole DNA Oligos, 0.1 ml/vial, sequence: GGTCCGTGTTTCAAGACGG, code: NL1R, Manufacturer: IDT, 100% new, CAS number: 56-81-5
- Trade date 2024/08/29 B/L No. ——
- Supplier integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 5.54
- Hs code 38229090 Product tags ——
- Product description Reagent used in the experiment, product name: 25 nmole DNA Oligos, 0.1 ml/vial, sequence: CCTCTGATACATCGTGTAAG, code: CPAlphaR, Manufacturer: IDT, 100% new, CAS number: 56-81-5
- Trade date 2024/08/29 B/L No. ——
- Supplier integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 15.38
- Hs code 38229090 Product tags ——
- Product description Reagent used in the experiment, product name: 100 nmole DNA Oligos, 0.1 ml/vial, sequence: GAT ACC ACA AGA TCR GCC GT, code: 2R, Manufacturer: IDT, 100% new, CAS number: 56-81-5
- Trade date 2024/08/29 B/L No. ——
- Supplier integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 9.59
- Hs code 38229090 Product tags ——
- Product description Reagent used in experiments, product name: 100 nmole DNA Oligos, 0.1 ml/vial, sequence: CGCAGACGGTTTAGCAAGTTTGGG, code: F28, Manufacturer: IDT, 100% new, CAS number: 56-81-5
- Trade date 2024/08/29 B/L No. ——
- Supplier integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 8.4
- Hs code 38229090 Product tags ——
- Product description Reagent used in the experiment, product name: 100 nmole DNA Oligos, 0.1 ml/vial, sequence: CTAATACATGCAAGTCGAACG, code: Pri-2, Manufacturer: IDT, 100% new, CAS number: 56-81-5
- Trade date 2024/08/29 B/L No. ——
- Supplier integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 5.54
- Hs code 38229090 Product tags ——
- Product description Reagent used in the experiment, product name: 25 nmole DNA Oligos, 0.1 ml/vial, sequence: CCAAATACTCTAATYGATGC, code: CPBeta2totalR, Manufacturer: IDT, 100% new, CAS number: 56-81-5
- Trade date 2024/08/29 B/L No. ——
- Supplier integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 5.81
- Hs code 38229090 Product tags ——
- Product description Reagent used in the experiment, product name: 25 nmole DNA Oligos, 0.1 ml/vial, sequence: AAATATGATCCTAACCAACAA, code: CPBeta2totalF2, Manufacturer: IDT, 100% new, CAS number: 56-81-5
- Trade date 2024/08/29 B/L No. ——
- Supplier integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 5.54
- Hs code 38229090 Product tags ——
- Product description Reagent used in the experiment, product name: 25 nmole DNA Oligos, 0.1 ml/vial, sequence: AATGGTCCTTTAAATAATCC, code: CPIotaF2, Manufacturer: IDT, 100% new, CAS number: 56-81-5
- Trade date 2024/08/29 B/L No. ——
- Supplier integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 8.46
- Hs code 38229090 Product tags ——
- Product description Reagent used in experiments, product name: 100 nmole DNA Oligos, 0.1 ml/vial, sequence: ATCAATTAACCTTCGAGCACCG, code: 23S-R, Manufacturer: IDT, 100% new, CAS number: 56-81-5
- Trade date 2024/08/29 B/L No. ——
- Supplier integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 8.08
- Hs code 38229090 Product tags ——
- Product description Reagent used in experiments, product name: 100 nmole DNA Oligos, 0.1 ml/vial, sequence: GTAAAACCAAAGCTTATCGTG, code: CC-F, Manufacturer: IDT, 100% new, CAS number: 56-81-5
- Trade date 2024/08/29 B/L No. ——
- Supplier integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 7.69
- Hs code 38229090 Product tags ——
- Product description Reagent used in experiments, product name: 100 nmole DNA Oligos, 0.1 ml/vial, sequence: CACTGGAGACTCTGAGGACA, code: ratA-F, Manufacturer: IDT, 100% new, CAS number: 56-81-5
Partners
- Rank Company Transactions Per Detail
- 1 integrated dna technologies inc. buyer,they trade on 2024-08-30 8072 49.83% >
- 2 new england biolabs pte ltd. supplier,they trade on 2024-08-27 1232 7.61% >
- 3 genscript biotech singapore pte ltd. supplier,they trade on 2024-08-01 1058 6.53% >
- 4 medtechca ltd. supplier,they trade on 2024-08-27 714 4.41% >
- 5 spark new investmentslimited supplier,they trade on 2022-05-20 669 4.13% > +View All
Products
- Products Transactions Per Detail
-
estradiol
4288 35.64% > -
laboratory reagents
4288 35.64% > -
hardened plastic
416 3.46% > -
stainless steel
416 3.46% > -
enteric bacilli
139 1.16% >
+View All
Hscode rank
- HSCode Name Transactions Per Detail
- 38229090 6552 54.46% >
- 38220090 4288 35.64% >
- 39269099 416 3.46% >
- 38210090 139 1.16% >
- 84798939 96 0.8% > +View All
Trading Area
- Area Transactions Per Detail
- united states 8901 54.95% >
- germany 1960 12.1% >
- singapore 1853 11.44% >
- china 1721 10.62% >
- netherlands 261 1.61% > +View All
Port statistics
- Port Name Transactions Per Detail
- noi bai airport vn 3117 19.24% >
- ha noi 117 0.72% >
- ho chi minh 7 0.04% >
- cang hai phong vn 5 0.03% >
- dinh vu nam hai vn 4 0.02% > +View All
bce vietnam co.ltd. is A Vietnam Buyer. This Company's Trade Report Mainly Contains Market Analysis, Contact, Trade Partners, Ports Statistics, And Trade Area Analysis. Official Reference Contact Is From Vietnam Original Bill Of Ladings, Including Email, Phone, Fax, Address, And Official Website. Till 2024-08-30，bce vietnam co.ltd.. A Total Of 16199 Transactions. Follow Up The Company, And Then Can Export This Company's Contact And B/Ls. If There Is New Transactions, We Will Also Inform You By The System.
We Extract The Trade Partners From bce vietnam co.ltd.'S 16199 Transctions. You Can Screen Companies By Transactions, Trade Date, And Trading Area. While You Can Check Product Type, Quantity, Price, And Trade Frequency Of Each Transaction. This Data Will Help You Study Your Competitors, Maintain And Monitor Your Customers, And Develop Target Users. Through Summary Statistics Of Transaction，We Extract This Company's Data Of Import-Export Ports And Trade Area, And Then You Can Check Related Data. It Can Calculate The Main Market And Occupation Of bce vietnam co.ltd.. All Around The World. Help You Deeply Analyze The Target Market, And Scientifically Formulate Production And Marketing Strategies.
Besides, We Are Trying Our Best To Provide Accurate Target Customers Recommend. Through Big Data, Recommend The Company That Buying Or Supplying The Same Product (Or HS Code) From The Vietnam's Buyer Company Database. That Including Email And Have Transaction Recently Will Be Pushed. So Suggest You Follow bce vietnam co.ltd., At The Same Time, Mark This Company's Industry And Products, It Will Help You Receive More Accurate Data Push.
We Extract The Trade Partners From bce vietnam co.ltd.'S 16199 Transctions. You Can Screen Companies By Transactions, Trade Date, And Trading Area. While You Can Check Product Type, Quantity, Price, And Trade Frequency Of Each Transaction. This Data Will Help You Study Your Competitors, Maintain And Monitor Your Customers, And Develop Target Users. Through Summary Statistics Of Transaction，We Extract This Company's Data Of Import-Export Ports And Trade Area, And Then You Can Check Related Data. It Can Calculate The Main Market And Occupation Of bce vietnam co.ltd.. All Around The World. Help You Deeply Analyze The Target Market, And Scientifically Formulate Production And Marketing Strategies.
Besides, We Are Trying Our Best To Provide Accurate Target Customers Recommend. Through Big Data, Recommend The Company That Buying Or Supplying The Same Product (Or HS Code) From The Vietnam's Buyer Company Database. That Including Email And Have Transaction Recently Will Be Pushed. So Suggest You Follow bce vietnam co.ltd., At The Same Time, Mark This Company's Industry And Products, It Will Help You Receive More Accurate Data Push.
Reference contact info
Business Information
Peer companies
-
daemyung vietnam co
Supplier，Activity value 77 -
cong ty tnhh nipro pharma viet nam
Buyer，Activity value 77 -
duy anh medical technologies co.ltd.
Buyer，Activity value 75 -
sixmurs hth vietnam trading co.ltd.
Buyer，Activity value 76 -
cong ty tnhh yujin kreves
Buyer，Activity value 77