bce vietnam co.ltd.
Trade trend analysis
Mon
|
Year
Number of Transactions Quantity Weight
Number of Transactions Quantity Weight
The above chart presents the market trend analysis for bce vietnam co.ltd. from 2023 to 2024. By examining various dimensions such as transaction quantity, transaction weight, average price, and transaction frequency, we can gain an intuitive understanding of the company's performance in terms of procurement cycles, business scale, and stability. As of 2024, the company has completed 3211 transactions, with a transaction quantity of 14537 and a transaction weight of 0.
- Year Transactions Quantity Weight
- 2023 5944 26001 6669.2
- 2024 3211 14537 0
Bill of lading data
< 1/15 >- Trade date 2024/08/30 B/L No. ——
- Suppliers integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 19724
- Hs code 38229090 Product tags ——
- Product description Reagent for laboratory use, not for medical use, product name: xGen Custom Hyb Panel, 96 reactions - 10 ml/bottle, code: GS_NIPT30SingleGenes_woUTR-V1, Manufacturer: IDT, 100% new, CAS number: 56-81-5 Expand
- Trade date 2024/08/29 B/L No. ——
- Suppliers integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 15.38
- Hs code 38229090 Product tags ——
- Product description Reagent used in the experiment, product name: 100 nmole DNA Oligos, 0.1 ml/vial, sequence: GAT ACC ACA AGA TCR GCC GT, code: 2R, Manufacturer: IDT, 100% new, CAS number: 56-81-5 Expand
- Trade date 2024/08/29 B/L No. ——
- Suppliers integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 9.59
- Hs code 38229090 Product tags ——
- Product description Reagent used in experiments, product name: 100 nmole DNA Oligos, 0.1 ml/vial, sequence: CGCAGACGGTTTAGCAAGTTTGGG, code: F28, Manufacturer: IDT, 100% new, CAS number: 56-81-5 Expand
- Trade date 2024/08/29 B/L No. ——
- Suppliers integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 19.22
- Hs code 38229090 Product tags ——
- Product description Reagent used in experiments, product name: 100 nmole DNA Oligos, 0.1 ml/vial, sequence: CTG CTC ATG GTA TCA ATC TTA TCG A, code: 2F, Manufacturer: IDT, 100% new, CAS number: 56-81-5 Expand
- Trade date 2024/08/29 B/L No. ——
- Suppliers integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 5.54
- Hs code 38229090 Product tags ——
- Product description Reagent used in the experiment, product name: 25 nmole DNA Oligos, 0.1 ml/vial, sequence: GGTTGGGTCTGCAGTTGAAG, code: OmpANhiF, Manufacturer: IDT, 100% new, CAS number: 56-81-5 Expand
- Trade date 2024/08/29 B/L No. ——
- Suppliers integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 8.84
- Hs code 38229090 Product tags ——
- Product description Reagent used in the experiment, product name: 100 nmole DNA Oligos, 0.1 ml/vial, sequence: ATAAATCGCCATTCGTTGACTAC, code: stx1-F, Manufacturer: IDT, 100% new, CAS number: 56-81-5 Expand
- Trade date 2024/08/29 B/L No. ——
- Suppliers integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 5.25
- Hs code 38229090 Product tags ——
- Product description Reagent used in experiments, product name: 25 nmole DNA Oligos, 0.1 ml/vial, sequence: GGTCCGTGTTTCAAGACGG, code: NL1R, Manufacturer: IDT, 100% new, CAS number: 56-81-5 Expand
- Trade date 2024/08/29 B/L No. ——
- Suppliers integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 5.54
- Hs code 38229090 Product tags ——
- Product description Reagent used in the experiment, product name: 25 nmole DNA Oligos, 0.1 ml/vial, sequence: CCTCTGATACATCGTGTAAG, code: CPAlphaR, Manufacturer: IDT, 100% new, CAS number: 56-81-5 Expand
- Trade date 2024/08/29 B/L No. ——
- Suppliers integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 8.4
- Hs code 38229090 Product tags ——
- Product description Reagent used in the experiment, product name: 100 nmole DNA Oligos, 0.1 ml/vial, sequence: CTAATACATGCAAGTCGAACG, code: Pri-2, Manufacturer: IDT, 100% new, CAS number: 56-81-5 Expand
- Trade date 2024/08/29 B/L No. ——
- Suppliers integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 5.54
- Hs code 38229090 Product tags ——
- Product description Reagent used in the experiment, product name: 25 nmole DNA Oligos, 0.1 ml/vial, sequence: CCAAATACTCTAATYGATGC, code: CPBeta2totalR, Manufacturer: IDT, 100% new, CAS number: 56-81-5 Expand
- Trade date 2024/08/29 B/L No. ——
- Suppliers integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 5.81
- Hs code 38229090 Product tags ——
- Product description Reagent used in the experiment, product name: 25 nmole DNA Oligos, 0.1 ml/vial, sequence: AAATATGATCCTAACCAACAA, code: CPBeta2totalF2, Manufacturer: IDT, 100% new, CAS number: 56-81-5 Expand
- Trade date 2024/08/29 B/L No. ——
- Suppliers integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 5.54
- Hs code 38229090 Product tags ——
- Product description Reagent used in the experiment, product name: 25 nmole DNA Oligos, 0.1 ml/vial, sequence: AATGGTCCTTTAAATAATCC, code: CPIotaF2, Manufacturer: IDT, 100% new, CAS number: 56-81-5 Expand
- Trade date 2024/08/29 B/L No. ——
- Suppliers integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 8.46
- Hs code 38229090 Product tags ——
- Product description Reagent used in experiments, product name: 100 nmole DNA Oligos, 0.1 ml/vial, sequence: ATCAATTAACCTTCGAGCACCG, code: 23S-R, Manufacturer: IDT, 100% new, CAS number: 56-81-5 Expand
- Trade date 2024/08/29 B/L No. ——
- Suppliers integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 8.08
- Hs code 38229090 Product tags ——
- Product description Reagent used in experiments, product name: 100 nmole DNA Oligos, 0.1 ml/vial, sequence: GTAAAACCAAAGCTTATCGTG, code: CC-F, Manufacturer: IDT, 100% new, CAS number: 56-81-5 Expand
- Trade date 2024/08/29 B/L No. ——
- Suppliers integrated dna technologies inc. Buyers bce vietnam co.ltd.
- POLs —— PODs ——
- Supply area United States Purchas area Vietnam
- Weight ——kg Amount 7.69
- Hs code 38229090 Product tags ——
- Product description Reagent used in experiments, product name: 100 nmole DNA Oligos, 0.1 ml/vial, sequence: CACTGGAGACTCTGAGGACA, code: ratA-F, Manufacturer: IDT, 100% new, CAS number: 56-81-5 Expand
Partners
Total 84- Rank Company Transactions Per Detail
- 1 integrated dna technologies inc. englandbuyer,they trade on 2024-08-30 8072 49.63% >
- 2 new england biolabs pte ltd. philippinessupplier,they trade on 2024-08-27 1232 7.57% >
- 3 genscript biotech singapore pte ltd. philippinessupplier,they trade on 2024-08-01 1058 6.5% >
- 4 medtechca ltd. germanysupplier,they trade on 2024-08-27 717 4.41% >
- 5 spark new investmentslimited chinasupplier,they trade on 2022-05-20 669 4.11% > +View All
Products
Total 114- Products Transactions Per Detail
-
laboratory reagents
2073 17.74% > -
estradiol
2073 17.74% > -
hardened plastic
450 3.85% > -
stainless steel
450 3.85% > -
stone pulp
111 0.95% >
+View All
Hscode rank
Total 135- HSCode Name Transactions Per Detail
- HS 38229090 8271 70.77% >
- HS 38220090 2073 17.74% >
- HS 39269099 450 3.85% >
- HS 38210090 111 0.95% >
- HS 84798969 105 0.9% > +View All
Trading Area
Total 29- Area Transactions Per Detail
- united states 8902 54.73% >
- germany 1962 12.06% >
- singapore 1910 11.74% >
- china 1721 10.58% >
- netherlands 264 1.62% > +View All
Port statistics
Total 11- Port Name Transactions Per Detail
- noi bai airport vn 3117 19.16% >
- ha noi 117 0.72% >
- hanoi 66 0.41% >
- ho chi minh 7 0.04% >
- cang hai phong vn 5 0.03% > +View All
bce vietnam co.ltd. is vietnam Buyer&Supplier,
and primarily engages in the import and export business of products such as laboratory reagents，estradiol，hardened plastic.
According to the 52wmb.com global trade database, as of 2024-08-30, the company has completed 16344 international trades,
with its main trading regions covering united states，germany,singapore etc.
The core products include HS38229090，HS38220090，HS39269099 etc,
often transported via noi bai airport vn，port ha noi, port hanoi etc,
and its main trading partners are integrated dna technologies inc.，new england biolabs pte ltd.，genscript biotech singapore pte ltd..
These trade data are sourced from various countries' customs and public channels, and have undergone standardization and structuring processing.
They can reflect the import and export trends and main market layout of the enterprise, and are suitable for market trend analysis, competitor research, port transportation planning, supply chain optimization, and international customer development.
They provide reliable support for cross-border trade decision-making.
The trade data displayed on bce vietnam co.ltd. is sourced from the 52wmb.com global trade database. It is based on legal records from customs and related public channels of various countries, and has been formatted and organized for user query and analysis.
We maintain compliance with the source and processing of data to ensure the objectivity of information, but due to the dynamic changes in international trade activities, some data may be delayed or changed.
Reference contact info
Email Hunting Tool