cella solutions

Activity value 72 india Buyer, the last transaction date was 2024-09-23 Detail
Accurate Match

Bill of lading data

< 1/15 >
Only shown the last 15 items, click more to check all
  • Trade date 2024/09/23 B/L No. 7521003
  • Supplier gene tools llc Buyers cella solutions
  • POLs —— PODs delhi air
  • Supply area United States Purchas area India
  • Weight —— Amount 52186.57
  • Hs code 29349990 Product tags aca,aac,r8,taf,mol,tacc,tca
  • Product description 300 nmol CO-300 WDR81MO 29-17Sep24B-L ATATACACTTGTTCAAACTTACCTAFOR RUO
+View All

Partners

Products

  • Products Transactions Per Detail
  • reagent
    25 80.65% >
  • acid base
    17 54.84% >
  • borato
    17 54.84% >
  • d la
    17 54.84% >
  • nucleic
    17 54.84% >
  • +View All

Hscode rank

  • HSCode Name Transactions Per Detail
  • 38221990 20 64.52% >
  • 38229090 8 25.81% >
  • 30021290 2 6.45% >
  • 29349990 1 3.23% >

Trading Area

  • Area Transactions Per Detail
  • indonesia 10 22.22% >
  • germany 1 2.22% >
  • japan 1 2.22% >

Port statistics

  • Port Name Transactions Per Detail
  • delhi 34 68% >
  • delhi air 16 32% >
cella solutions is A India Buyer. This Company's Trade Report Mainly Contains Market Analysis, Contact, Trade Partners, Ports Statistics, And Trade Area Analysis. Official Reference Contact Is From India Original Bill Of Ladings, Including Email, Phone, Fax, Address, And Official Website. Till 2024-09-23,cella solutions. A Total Of 50 Transactions. Follow Up The Company, And Then Can Export This Company's Contact And B/Ls. If There Is New Transactions, We Will Also Inform You By The System.

We Extract The Trade Partners From cella solutions'S 50 Transctions. You Can Screen Companies By Transactions, Trade Date, And Trading Area. While You Can Check Product Type, Quantity, Price, And Trade Frequency Of Each Transaction. This Data Will Help You Study Your Competitors, Maintain And Monitor Your Customers, And Develop Target Users. Through Summary Statistics Of Transaction,We Extract This Company's Data Of Import-Export Ports And Trade Area, And Then You Can Check Related Data. It Can Calculate The Main Market And Occupation Of cella solutions. All Around The World. Help You Deeply Analyze The Target Market, And Scientifically Formulate Production And Marketing Strategies.

Besides, We Are Trying Our Best To Provide Accurate Target Customers Recommend. Through Big Data, Recommend The Company That Buying Or Supplying The Same Product (Or HS Code) From The India's Buyer Company Database. That Including Email And Have Transaction Recently Will Be Pushed. So Suggest You Follow cella solutions, At The Same Time, Mark This Company's Industry And Products, It Will Help You Receive More Accurate Data Push.

Reference contact info

Business Information


Peer companies

Whatsapp:+8616621075894(9:00 Am-18:00 Pm (SGT))

About us Contact us Advertise Buyer Supplier Company report Industry report

©2010-2024 52wmb.com all rights reserved